Why Is the First 150 Base Pairs of Sequence Bad Reads?

Ane of the about important factors in successful automated Dna sequencing is proper primer design. This document describes the steps involved in this procedure and the major pitfalls to avoid.

**** Use a Figurer to Design Primers ****

Nosotros highly recommend that a estimator be used during primer design in order to check for certain fatal pattern flaws. Numerous programs are capable of performing this analysis. For example, expect for 'Primer3' on the web.

Some Basic Concepts: If you lot are confused past the strands and primer orientation, read this.

Sequencing primers must exist able to anneal to the target DNA in a predictable location and on a predictable strand. They furthermore must be capable of extension by Taq Deoxyribonucleic acid Polymerase.

Some people are confused about how to examine a Deoxyribonucleic acid sequence to choose an appropriate primer sequence. Here are a few things for novices to remember:

• Sequences are ever written from 5′ to 3′. This includes the sequence of your template DNA (if known), the sequence of the vector Deoxyribonucleic acid into which information technology is inserted, andthe sequence of proposed primers. Don't ever write a primer sequence reversed or you volition only misfile yourself and others.
• Polymerase always extends the iii′ end of the primer, and the sequence you will read volition bethe same strand (sense or anti-sense) equally the primer itself.
• Thus, if yous choose a primer sequence that you lot can read in your source sequence (for case, in the vector), the sequence you will obtain will extend from the primer's right (3′) end .
• Conversely, if you choose a primer from the strand reverse to what your 'source' sequence reads,the resulting sequence will read towards the left.

Here are a couple of examples:

Suppose you accept a vector with the following sequence effectually the Multiple Cloning Site (the 'MCS'):

                  TTAGCTACTGCTTGATGCTAGTACTACATCTAGTGCTAGATGGATCCGAATTCGCTGATGCTCATATGTTAATAAAGAC                                                                             ^     ^                                                                             |     |                                                                           BamHI EcoRI                

If you cloned your Deoxyribonucleic acid of interest between the BamHI and EcoRI sites, you could sequence using the primer 'CTTGATGCTAGTACTACATC' (remember – that's written 5′ to 3′) and you'll obtain the following sequence from the Cadre:

                  TAGTGCTAGATG[your-insert-'tiptop'-strand-Bam-to-Eco]AATTCGCTGATGC...(etc.)                

What if you wanted sequence from the other strand – Eco to Bam – instead? In that example, you need to select some sequence on theright and thenreverse-complement it before requesting the oligo. Picking out some sequence from the figure above:

                  CTGATGCTCATATGTTAATA                

This is NOT the primer sequence – it is copied verbatim from the above sequence. In fact, if you used this sequence for a primer, sequencing would proceedtowards the right, abroad from your insert. Instead, reverse-complement that sequence:

                  TATTAACATATGAGCATCAG                

Now this should produce the sequence of the opposite strand:

                  CGAATT[your-insert-'bottom'-strand-Eco-to-Bam]CATCTAGCACTA...(etc.)                

Some fine print: Just rarely does sequencing actually show the nucleotides immediately downstream from the primer. I've taken some didactic license in the examples above.

---

More Advanced Concepts: How to Blueprint a Primer that Works.

Generally, y'all are starting with some small-scale corporeality of known sequence that you wish to extend. Here's how to proceed:

I.Design primers but from authentic sequence data.

Automated sequencing (and in fact whatsoever sequencing) has a finite probability of producing errors. The sequence obtained too far away from the primer must be considered questionable. To make up one's mind what is 'as well far', nosotros strongly suggest that our clients read the memo Interpretation of Sequencing Chromatograms, which describes how to appraise the validity of information obtained from the ABI sequencers. Select a region for primer placement where the possibility of sequence fault is low.

Two.Restrict your search to regions that best reflect your goals.

You may be interested in maximizing the sequence data obtained, or you may merely need to examine the sequence at a very specific location in the template. Such needs dictate very unlike primer placements.

1. Maximize sequence obtained while minimizing the potential for errors:
   Generally, you should design the primer every bit far to the 3′ as you lot can manage so long every bit you lot have conviction in the accuracy of the sequence from which the primer is drawn. Primers on opposite strands should exist placed in a staggered manner as much as possible.
2. Targetted sequencing of a specific region:
   Position the primer so the desired sequence falls in the most accurate region of the chromatogram. Sequence information is oft near accurate most lxxx-150 nucleotides away from the primer. Do not count on seeing good sequence less than 50 nucleotides away from the primer or more than 300 nt away (although nosotros oft get sequence starting immediately after the primer, and we oftentimes return 700 nt of accurate sequence).

III.Locate candidate primers:

Identify potential sequencing primers that produce stable base pairing with the template Dna under weather appropriate for cycle sequencing. It isstrongly suggested that y'all apply a computer at this step. Suggested primer characteristics:

1. Length should be between 18 and 30 nt, with optimal being 20-25 nt. (Although we have had some successes with primers longer than 30 and shorter than 18).
2. Thou-C content of 40-threescore% is desirable.
3. The Tm should be betwixt 55 C and 75 C. Alert: the sometime "four degrees for each G-C, 2 degrees for each A-T" rule works poorly, especially for oligos shorter than 20 or longer than 25 nt. Instead, try:

                           Tm = 81.five + 16.six* log[Na] + 0.41*(%GC) - 675/length - 0.65*(%formamide) - (%mismatch)

Four.Discard candidate primers that show undesirable self-hybridization.

Primers that can self-hybridize volition be unavailable for hybridization to the template. Generally avoid primers that can form 4 or more consecutive bonds with itself, or 8 or more bonds full. Example of a marginally problematic primer:

                    5'-ACGATTCATCGGACAAAGC-3'                                                    ||||  ||||                                         3'-CGAAACAGGCTACTTAGCA-v'

This oligo forms a substantially stable dimer with itself, with four sequent bonds at 2 places and a full of 8 inter-strand bonds.

Primers with 3′ ends hybridizing fifty-fifty transiently volition become extended due to polymerase activity, thus ruining the primer and generating false bands. Be somewhat more stringent in avoiding 3′ dimers. For example, the following primer self-dimerizes with a perfect 3′ hybridization on itself:

                    5'-CGATAGTGGGATCTAGATCCC-3'                                                        ||||||||||||||                                                     three'-CCCTAGATCTAGGGTGATACG-five'

The above oligo is pretty bad, and most guaranteed to crusade problems. Note that the polymerase will extend the iii′ end during the sequencing reaction, giving very strong sequence ACTATGC. These bands will appear at the commencement of your 'existent' information equally immense peaks, occluding the right sequence. Most primer design programs volition correctly spot such self-dimerizing primers and will warn you to avert them.

Annotation notwithstanding that no calculator program or rule-of-thumb assessment can accurately predict either success or failure of a primer. A primer that seems marginal may perform well, while another that appears to exist flawless may not work at all. Avoid obvious problems, pattern the best primers you lot tin can, just in a pinch if y'all have few options, but try a few candidate primers, regardless of potential flaws.

V.Verify the site-specificity of the primer.

Perform a sequence homology search (e.grand. dot-plot homology comparison) through all known template sequence to check for culling priming sites. Discard any primers that display 'meaning' tendency to bind to such sites. Nosotros tin can provide only rough guidelines as to what is 'significant'. Avoid primers where alternative sites are present with (ane) more than ninety% homology to the primary site or (ii) more than than 7 consecutive homologous nucleotides at the 3′ end or (iii) abundance greater than five-fold college than the intended priming site.

Vi.Choosing among candidate primers.

If at this point you have several candidate primers, yous might select ane or a few that are more A-T rich at the 3′ end. These tend to exist slightly more than specific in action, co-ordinate to some investigators. You may want to use more one primer, maximizing the likelihood of success.

If you have no candidates that survived the criteria in a higher place, then yous may be forced to relax the stringency of the pick requirements. Ultimately, the test of a skillful primer is just in its use, and cannot be accurately predicted by these simplistic rules-of-thumb.

With luck, though, you lot accept enough of options for primers. For a sequence assembly projection, design more primers than you recollect you really need and so that if the sequence isn't as long as yous hoped, you might still obtain sufficient overlapping data to assure you lot of a good sequence consensus. Nosotros recommend that you sequenceboth strands, for better confirmation. On 1 strand, space the primers 500 to 700 nt office (shorter spacing is safer!). On the reverse strand, identify the primers in staggered fashion away from the first strand primers, as depicted below:

johnsonovertaker.blogspot.com

Source: https://brcf.medicine.umich.edu/cores/advanced-genomics/faqs/sanger-sequencing-faqs/how-do-i-design-my-own-primers/

Share this post